View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_61 (Length: 229)
Name: NF10211_low_61
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 11 - 210
Target Start/End: Complemental strand, 7351155 - 7350956
Alignment:
| Q |
11 |
gagagatgaactattgttgctaatggtaccgactcactgtatcttttctatgatataaagtgtgggattgtgagaaccagtagaaatcaaactccattct |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
7351155 |
gagacatgaactattgttgctaatggtaccgactcactgtatcttttctatgatataaagtgtgggattgtgagatccagtagaaatcaaactctattct |
7351056 |
T |
 |
| Q |
111 |
catcacgaattagtagcacatcatcgattgccttccttcatagactttgtagacaataactgcaattagtagcattggtaaattgtcatgcgaaggtagc |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7351055 |
catcacgaattagtagcacatcattgattgccttccttcatagactttgtagacaataactgcaattagtagcattggtaaattgtcatgcgaaggtagc |
7350956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University