View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10211_low_62 (Length: 226)
Name: NF10211_low_62
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10211_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 224
Target Start/End: Original strand, 36525933 - 36526149
Alignment:
| Q |
8 |
atttatattatttagggactaattatatttacataatttagacttcaaattgaagtgtaagtgatagtttacggactacatcgatggtttattcttcgtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36525933 |
atttatattatttagggactaattatatttacataatttagacttcaaattgaagtgtaggtgatagtttacagactacatcgatggtttattcttcgtt |
36526032 |
T |
|
| Q |
108 |
ttccccacgatgctattgttactatctatattactaccgtatagagagagcaatataaaaatactggataacataaaacagatagccccccaaagcggca |
207 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
36526033 |
ttccctgcaatgctattgttactatctatattactatcgtatagagagagcaatataaaaatactggaaaacataaaacagatagccccccaaagtggca |
36526132 |
T |
|
| Q |
208 |
tatgcattgcgacgtta |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36526133 |
tatgcattgcgacgtta |
36526149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University