View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10211_low_65 (Length: 217)

Name: NF10211_low_65
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10211_low_65
NF10211_low_65
[»] chr7 (1 HSPs)
chr7 (1-73)||(26895081-26895153)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 26895081 - 26895153
Alignment:
1 tgacctctatctacactctttgagccttaatacatgtcttgaccttggtgagctcctaagatccaactcacct 73  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26895081 tgacctctatctacactctttgagccttaatacatgtcttgaccttggtgagctcctaagatccaactcacct 26895153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University