View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10213_low_12 (Length: 297)
Name: NF10213_low_12
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10213_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 46901526 - 46901593
Alignment:
| Q |
1 |
aaatgtaatgtaatgtggtgaatgatgttcttgtgttttgtgttgtaaggtgatggtgtatattatag |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901526 |
aaatgtaatgtaatgtggtgaatgatgttcttgtgttttgtgttgtaaggtgatggtgtatattatag |
46901593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 205 - 276
Target Start/End: Original strand, 46901929 - 46902000
Alignment:
| Q |
205 |
aaataaattcatcaagcaaatcttgaacaatcgctcccatgcagatattattgttctgctgctggaactaaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46901929 |
aaataaattcatcaagcaaatcttgaacaatcgctcccatgcagatattattgttcttgtgctggaactaaa |
46902000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 46901663 - 46901713
Alignment:
| Q |
141 |
tatgttgtgctcttaattgaaaatggttttcacttgtcaattatatctata |
191 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901663 |
tatgttgtgctcttgattgaaaatggttttcacttgtcaattatatctata |
46901713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University