View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10213_low_15 (Length: 261)
Name: NF10213_low_15
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10213_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 23378251 - 23378009
Alignment:
| Q |
1 |
ttggtcacttgaatttagggttttaaggtgatttaagagtgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23378251 |
ttggtcacttgaatttagggttttgaggtgatttaagagcgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggatt |
23378152 |
T |
|
| Q |
101 |
gtgagatgttt-atgttcattgagaagtcaatcaatgtgcttaatgtcttgctactcttggttataatgaaagacttgattcgacaaaactctcatcccc |
199 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23378151 |
gtgagatcaaacatattcattgagaagtcaatcaatgtgcttaatgtcttgttactcttggttataatgacagacttgattcgacaaaactctcatcccc |
23378052 |
T |
|
| Q |
200 |
aaccttctttattttttattacttcataatgattgtagaatgat |
243 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23378051 |
aaccttctttat-ttttattacttcataatgattgtagaatgat |
23378009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University