View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10213_low_17 (Length: 259)
Name: NF10213_low_17
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10213_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 41690930 - 41691155
Alignment:
| Q |
16 |
aacaaattcgtcaccttaaaattggggattgaaacatcttctttcaacacactcttagagaagacaataaatgtgatgtttgagatacaaagtattgagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
41690930 |
aacaaattcgtcaccttaaaattggggattgaaacatcttctttcaacacactcttagagaagacaatgaatgtgatgtctgagatacaaagtattgagc |
41691029 |
T |
 |
| Q |
116 |
ccctttcaataacatcttgaagatttagatcaattgtcctcctcggctcaatcccgtgttgtctgctgatgttgtaggtgttgcttgttcgtgagcctag |
215 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41691030 |
ctctttcaataacatcttgaagatttagatcagttgtcctccttagctcaatctcgtgttgtctgctgatgttgtaggtgttgcttgttcgtgagcctag |
41691129 |
T |
 |
| Q |
216 |
tttcatttatttttccttgttttctt |
241 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
41691130 |
tttcatttatttttccttgttttctt |
41691155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University