View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10213_low_26 (Length: 241)
Name: NF10213_low_26
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10213_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 39 - 226
Target Start/End: Original strand, 37664846 - 37665033
Alignment:
Q |
39 |
tgagattgaaatgtgaaatgcaatacagaaacagaccgtttgtttttaatagaagtaattcacggtgctaatcttcttcttcgtcggaatggtaaaggca |
138 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
37664846 |
tgagattgaaatgtgaaatgcaatacagaaacagaccgtttgtttttaatagaagtaattcacggtgctaatcttcttcttcgtcggaatggtgaaggca |
37664945 |
T |
 |
Q |
139 |
tgtttgatttggcgggaaaatgaaaactggattggtagttaatttcgatgattgattcttctcaacgttgttaggtatatggtctgtg |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37664946 |
tgtttgatttggcgggaaaatgaaaactggattggtagttaatttcgatgattgattcttctcaacgttgttaggtatatggtctgtg |
37665033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University