View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10213_low_27 (Length: 241)
Name: NF10213_low_27
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10213_low_27 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 30134339 - 30134116
Alignment:
Q |
18 |
acttgtgattagatctgagtagatggatactaacttgtttggcatgtgaattgtgaatacttgccgttcttagttcttgagagtgtcatctgacttggta |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
T |
30134339 |
acttgtgattagatctgagtagatggatactaacttgtttggcatgtgaattgtgaatacttgccgttcttagttcttgacagtgtcatcttacttggta |
30134240 |
T |
 |
Q |
118 |
ttaggatcaattaagttggtccctaaatatttgatgcggtgtcaccgtataggttctgaatgtattgaaattacaaaaacatttgagtgtgttttttgtt |
217 |
Q |
|
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
30134239 |
ttaggatcaattaagttggtccctaaatatgtgattcggtgtcaccgtataggttctgaatgtattgaaattacaaaaacatctgagtgtgttttttgtt |
30134140 |
T |
 |
Q |
218 |
agtaatttcgtgaactaagctaac |
241 |
Q |
|
|
|||||||| ||||||||| ||||| |
|
|
T |
30134139 |
agtaattttgtgaactaaactaac |
30134116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University