View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10213_low_30 (Length: 224)
Name: NF10213_low_30
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10213_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 3 - 64
Target Start/End: Original strand, 2250294 - 2250355
Alignment:
Q |
3 |
aaactttggtattgcctttatagatagttatagattgcatgtttccctttctcctctgtaac |
64 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
2250294 |
aaactttggtattgcctttatagatagttatagattggatgtttccctttctcctctgtaac |
2250355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 2250429 - 2250485
Alignment:
Q |
138 |
gcaatagaattgaacaaacgtggctgcaatgatcacaaagattccatattcttcctc |
194 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
2250429 |
gcaatataattgaacaaacgtggctgcaatgatcacaaagattccatgttcttcctc |
2250485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University