View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10213_low_30 (Length: 224)

Name: NF10213_low_30
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10213_low_30
NF10213_low_30
[»] chr1 (2 HSPs)
chr1 (3-64)||(2250294-2250355)
chr1 (138-194)||(2250429-2250485)


Alignment Details
Target: chr1 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 3 - 64
Target Start/End: Original strand, 2250294 - 2250355
Alignment:
3 aaactttggtattgcctttatagatagttatagattgcatgtttccctttctcctctgtaac 64  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
2250294 aaactttggtattgcctttatagatagttatagattggatgtttccctttctcctctgtaac 2250355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 2250429 - 2250485
Alignment:
138 gcaatagaattgaacaaacgtggctgcaatgatcacaaagattccatattcttcctc 194  Q
    |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||    
2250429 gcaatataattgaacaaacgtggctgcaatgatcacaaagattccatgttcttcctc 2250485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University