View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10214_low_11 (Length: 243)
Name: NF10214_low_11
Description: NF10214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10214_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 2760556 - 2760346
Alignment:
| Q |
20 |
tttacttctttacctaaaattttgaatcttgtcattattctttggaggataaacttgattagcttttatggaaacatttaaattccgatgacttgcagtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2760556 |
tttacttctttacctaaaattttgaatcttgtcattattctttggaggataaacttgattagcttttatggaaacattcaaattccgatgacttgcagtt |
2760457 |
T |
|
| Q |
120 |
gaatgaaatattattttttggagattgatgcatggaaagatctccacttatgagaatttggcaatgagagggtgccagatgctctcgttgtcaataatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2760456 |
gaatgaaatattattttttggagattgatgcatggaaagatctccacttatgagaatttggcaatgagagggtgccagatgctctcgttgtcaataatgt |
2760357 |
T |
|
| Q |
220 |
agaaagttctt |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
2760356 |
agaaagttctt |
2760346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University