View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10215_high_11 (Length: 251)
Name: NF10215_high_11
Description: NF10215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10215_high_11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 40925859 - 40926109
Alignment:
| Q |
1 |
tcatgtcaagcccaagagaaccaactttaggcatgtattttttcataatctcatatcttccctgagtcacaacaaaaagacagatagcatgtaattgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925859 |
tcatgtcaagcccaagagaaccaactttaggcatgtattttttcataatctcatatcttccctgagtcacaacaaaaagacagatagcatgtaattgaat |
40925958 |
T |
 |
| Q |
101 |
tgagttagttaaggtnnnnnnngaagcattgtcattgttcggttactaagtggaatagtatcatccgaattccacatgtcattcccatggagctcaaatg |
200 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925959 |
tgagttagttaaggtaaaaaaagaagcactgtcattgttcggttactaagtggaatagtatcatccgaattccacatgtcattcccatggagctcaaatg |
40926058 |
T |
 |
| Q |
201 |
ttactaagaaaaggttgtcagttgtcacaataatctcaagtcactgtggta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40926059 |
ttactaagaaaaggttgtcagttgtcacaataatctcaagtcactgtggta |
40926109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University