View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10215_high_12 (Length: 248)
Name: NF10215_high_12
Description: NF10215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10215_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 23 - 233
Target Start/End: Original strand, 14085266 - 14085476
Alignment:
| Q |
23 |
aagaattaccttcatgtttttggacaaacattcatatgtttaagcatgttgttagttcgatggctagaactatttgacgcaaaagaagcaaaacagaagt |
122 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14085266 |
aagaatcaccttcatgtttttggacaaacattcatatgtttaagcatgttgttagtttgatggctagaactatttgacgcaaaagaagcaaaacagaagt |
14085365 |
T |
 |
| Q |
123 |
tacaaaatgtggcgtatgcgtctcttttcttcgtaaaatgtctccaagccattgaaggatgtctatcatgttttcttttctttagttttagcactaactc |
222 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14085366 |
tacaaaattcggcgtatgcgtctcttttcttcgtaaaatgtctccaagccattgaaggatgtctatcatgttttcttttctttagttttagcactaactc |
14085465 |
T |
 |
| Q |
223 |
agcatgttcat |
233 |
Q |
| |
|
| ||||||||| |
|
|
| T |
14085466 |
aacatgttcat |
14085476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 29 - 232
Target Start/End: Complemental strand, 12190097 - 12189900
Alignment:
| Q |
29 |
taccttcatgtttttggacaaacattcatatgtttaagcatgttgttagttcgatggctagaactatttgacgcaaaagaagcaaaacagaagttacaaa |
128 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||| | ||| |||||| ||||||||| || || ||||||||| |
|
|
| T |
12190097 |
taccttcatgtttttggacaaatcatcatgtgtttaagcatgttgttagttcgatggttggaagcatttgaaacaaaagaagtgaagcaatagttacaaa |
12189998 |
T |
 |
| Q |
129 |
atgtggcgtatgcgtctcttttcttcgtaaaatgtctccaagccattgaaggatgtctatcatgttttcttttctttagttttagcactaactcagcatg |
228 |
Q |
| |
|
| ||| | |||| |||||||| |||||||||||||| ||||||||||| ||||| || ||||||||||||||||||||||||||| || |||||| |
|
|
| T |
12189997 |
a---ggca---gtgtcttttttcttcataaaatgtctccaaaccattgaaggaggtctagcaggttttcttttctttagttttagcactaccttagcatg |
12189904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University