View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10215_low_17 (Length: 218)
Name: NF10215_low_17
Description: NF10215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10215_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 25 - 90
Target Start/End: Complemental strand, 11227025 - 11226960
Alignment:
| Q |
25 |
cagcttaccatagtaatcaagttctatgatgtcaaccaatttcccataatacatctcatcacttga |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11227025 |
cagcttaccatagtaatcaagttctatgatgtcaaccaatttcccataatacatctcatcacttga |
11226960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University