View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10215_low_18 (Length: 215)
Name: NF10215_low_18
Description: NF10215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10215_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Complemental strand, 38128875 - 38128684
Alignment:
| Q |
14 |
cataggataagggtggttgaagttaggactttatacagaagacatattggaccacaaaagtttgtgtctttggtgtgtattaattttagtgtatccagct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38128875 |
cataggataagggtggttgaagttaggactttatacagaagacatattggaccacaaaagtttgtgtctttggtgtgtattaattttagtgtatccagct |
38128776 |
T |
|
| Q |
114 |
cattcaagtctatctggcaagcatgccaaaaatgctacaagtatacatgtcattgttttttctacagtaatcattttgtagattattgatgt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38128775 |
cattcaagtctatctggcaagcatgccaaaaatgctacaagtatacatgtcattgttttttctacagtaatcattttctagattattgatgt |
38128684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University