View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10216_low_10 (Length: 290)
Name: NF10216_low_10
Description: NF10216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10216_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 90 - 272
Target Start/End: Original strand, 7657638 - 7657820
Alignment:
| Q |
90 |
gaaacctctcacaatattttcctttttcttcgaaaatattacaaatgtacgcaatgaaattcatcacactattcttaggtttgccgtgtgactataagct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7657638 |
gaaacctctcacaatattttcctttttcttcaaaaatattacaaatgtacgcaatgaaattcatcacactattcttaggtttgccgtgtgactataagct |
7657737 |
T |
 |
| Q |
190 |
ataaaatatacatagatcacctcacacactctaaagtcatgagcaaaaattcagccattaaaccgtaaaaatatgaagtgcat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7657738 |
ataaaatatacatagatcacctcacacactctaaagtcatgagcaaaaattcagccattaaaccgtaaaaatatgaattgcat |
7657820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University