View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10216_low_12 (Length: 259)
Name: NF10216_low_12
Description: NF10216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10216_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 241
Target Start/End: Original strand, 28191084 - 28191311
Alignment:
| Q |
14 |
agacagagacatttatttgatgtaactgattttgtcttggtgaggaagtcagtcaccatcaccaccctctttggaggtgttattttcattgtttattgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28191084 |
agacagagacatttatttgatgtaactgattttgtcttggtgaggaagtcagtcaccatcaccaccgtctttggaggtgttattttcattgtttattgtt |
28191183 |
T |
|
| Q |
114 |
tagaaaacatatttgtgcacattaggtcccttcaggtgattgtttaatcccaggattgaatcccatcgaagccacttcacttatactgacatcatatcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28191184 |
tagaaaacatatttgtgcacattaggtcccttcaggtgattgtttaatcccaggattgaatcccatcgaagccacttcacttatactgacatcatatcat |
28191283 |
T |
|
| Q |
214 |
aacctgatttataggcatggcaccaacc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28191284 |
aacctgatttataggcatggcaccaacc |
28191311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University