View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10216_low_14 (Length: 242)
Name: NF10216_low_14
Description: NF10216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10216_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 97 - 224
Target Start/End: Complemental strand, 13799896 - 13799769
Alignment:
| Q |
97 |
actaacacccatcttcaccatgaaatcagctgtagcatttgcctcccaccacgtatgactcagttggaaattccagtcacgagccattagatccttgata |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13799896 |
actagcacccatcttcaccatgaaatcagctgtagcatttgcctcccaccacgtatgactcagttggaaattccagtcgcgagccattagatccttgata |
13799797 |
T |
|
| Q |
197 |
ttgctgataacaggtgcaaagaggtgcc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13799796 |
ttgctgataacaggtgcaaagaggtgcc |
13799769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 32 - 222
Target Start/End: Original strand, 49921496 - 49921686
Alignment:
| Q |
32 |
tcatcctgcagaagaggcaagactgcatcaggtggttctaaaaactcctgccagacttcattacaactaacacccatcttcaccatgaaatcagctgtag |
131 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| |||||||||||| |||| ||||| | | ||||||||| |||||||||||||||| | |
|
|
| T |
49921496 |
tcatcctgcagcagaggcaagataccatcaggtggttctacaaactcctgccaagcttcgttacagttcgcgcccatcttcgccatgaaatcagctgtgg |
49921595 |
T |
|
| Q |
132 |
catttgcctcccaccacgtatgactcagttggaaattccagtcacgagccattagatccttgatattgctgataacaggtgcaaagaggtg |
222 |
Q |
| |
|
|||| ||||||| |||||||||||||||||| |||| ||| || |||||||| || ||||| ||||||||||||| |||||||| ||||| |
|
|
| T |
49921596 |
cattcgcctcccgccacgtatgactcagttgtaaatgccaatcgcgagccatcaggtcctttatattgctgataatgggtgcaaaaaggtg |
49921686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University