View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10217_low_3 (Length: 297)
Name: NF10217_low_3
Description: NF10217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10217_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 290
Target Start/End: Original strand, 1161552 - 1161826
Alignment:
Q |
16 |
ggttggacttgtgtgaagagggatccttgtgaataatgatttatttaaacttcaagatcaggtctttgtaattaactgttcttaagcttagttagccgag |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1161552 |
ggttggacttgtgtgaagagggatccttgtgaataatgatttatttaaacttcaagatcaggtctttgtaattaactgttcttaagcttagttagccgag |
1161651 |
T |
 |
Q |
116 |
ggaatgttttgctgctatgtgtatgtgttgaagaccatgctgtagctaacttggttatgtgcattgcatagcacatggatggttcctttctcactcactc |
215 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1161652 |
ggaatgttttgctgctatgtgtatgtgttgaagaccatgctgtagctgacttggttatgtgcattgcatagcacatggatggttcctttctcactcactc |
1161751 |
T |
 |
Q |
216 |
tacgtctgcggctacacacataatttctttgttgtcgacatgaaattggaaacgacaccaatggagcctatgctt |
290 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
1161752 |
tatgtctgcggctacacacataatttctttgttgtcgacatgaaattggaaacgacaccaatggagcttatgctt |
1161826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 26 - 279
Target Start/End: Complemental strand, 879674 - 879414
Alignment:
Q |
26 |
gtgtgaagagggatccttgtgaataatgatttatttaaacttcaagatcaggtctttgtaattaactgttcttaagcttagttagccgagggaatgtttt |
125 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||| |||| |
|
|
T |
879674 |
gtgtgaagagggatccttgtaaataatgatttatttaaacttcaagatcaggtctttgtaattaactgttccaaagctttattagcagagggaatatttt |
879575 |
T |
 |
Q |
126 |
gctgctatgtgtatgtgttgaagaccatgct-------gtagctaacttggttatgtgcattgcatagcacatggatggttcctttctcactcactctac |
218 |
Q |
|
|
|||||||||||||||||||||||| |||||| |||||| | |||||||||||||||||||||||||| |||| ||||||||||||||| ||||| |
|
|
T |
879574 |
gctgctatgtgtatgtgttgaagatcatgctgcttatggtagctgaattggttatgtgcattgcatagcacat-gatgcttcctttctcactcattctac |
879476 |
T |
 |
Q |
219 |
gt-ctgcggctacacacataatttctttgttgtcgacatgaaattggaaacgacaccaatgg |
279 |
Q |
|
|
|| ||||| |||||||| ||||||||| |||||||| |||||||| |||| ||||||||| |
|
|
T |
879475 |
gtcctgcgactacacacgtaatttcttggttgtcgatatgaaattacgaacggcaccaatgg |
879414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University