View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10217_low_6 (Length: 232)
Name: NF10217_low_6
Description: NF10217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10217_low_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 3612024 - 3611794
Alignment:
| Q |
1 |
gctttttatattcaatctaactgaaataaacaaaaaggatagttgctctataagtgcagcgggtttgcaaagagataactttcgatcacccaaaaattac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3612024 |
gctttttatattcaatctaactgaaataaacaaaaaggatagttgctctataagtgcagcgggtttgcaaagagataactttcgatcacccaaaaattac |
3611925 |
T |
|
| Q |
101 |
agaaaatatgattctatcgacnnnnnnnnnnnnnnnnnnngcatcgaaaactatcttcctatcagtttatttcaaatgttgaacaatccatgaagcaatt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3611924 |
agaaaatatgattctatcgac-ttttttttttgtttttttgcatcgaaaactatcttcctatcagtttatttcaaatgttgaacaatccatgaagcaatt |
3611826 |
T |
|
| Q |
201 |
gtcaacaacaaaactgtattttctaaatattt |
232 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
3611825 |
gtcaacaacaaaactgtattttttaaatattt |
3611794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University