View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10218_high_15 (Length: 252)
Name: NF10218_high_15
Description: NF10218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10218_high_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 31044010 - 31043769
Alignment:
| Q |
11 |
gagatgaagtcaccaaagtcattaaattcaaagtcatcgaaatgtaaccccaattataactccggaaattgttagcattagtaaggctcatttcaatgct |
110 |
Q |
| |
|
||||| ||||||||||| | | |||||||||||||| |||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31044010 |
gagataaagtcaccaaaattactaaattcaaagtcaccgaaatttaaccccgattataacttcggaaattgttagcattagtaaggctcatttcaatgct |
31043911 |
T |
 |
| Q |
111 |
aagaccagacaaacccttgttttaggtcctcaacaccccaacccaactcccaacatagctcattaattttataacatctattttgatacttatattgcac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31043910 |
aagaccagacaaacccttgttttaggtcctcaacaccccaacccaactcccaacatagctcattaattttataacatctattttgatacttatattgcac |
31043811 |
T |
 |
| Q |
211 |
acggcacctcttcttatgacttgtttaaaatgagatagatct |
252 |
Q |
| |
|
| |||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
31043810 |
atggcaactcttcttacgacttgtttaatatgagatagatct |
31043769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University