View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10218_low_22 (Length: 239)
Name: NF10218_low_22
Description: NF10218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10218_low_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 43511688 - 43511926
Alignment:
| Q |
1 |
aaacacgttgaaatcttcgagatcagagctttgtgaaaaacttcatcttgataacaacgatctggttccttgggttttgattttcttaaaacagagcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43511688 |
aaacacgttgaaatcttcgagatcagagctttgtgaaaaacttcatcgtgataacaacgatctggttccttgggttttgattttcttaaaacagagcatg |
43511787 |
T |
 |
| Q |
101 |
aactgaaacgacaccgtttaaacgatcttcatgtttctgaaacatgaagnnnnnnnnnatgatgagattgaggaaag--tgnnnnnnnnngtaagaagga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
43511788 |
aactgaaacgacaccgtttaaacgatcttcatgtttatgaaacatgaagtttttttttatgatgagattgaggaaagtatttttttttttgtaagaagga |
43511887 |
T |
 |
| Q |
199 |
atctctagcacagtgaaatgaagtgtattaataactttttt |
239 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43511888 |
atctctagcacagtgaaatgaa--gtattaataactttttt |
43511926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University