View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10218_low_25 (Length: 229)
Name: NF10218_low_25
Description: NF10218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10218_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 28998360 - 28998531
Alignment:
| Q |
1 |
tttctggcaacatctacttttgagctctaggtctatgtcatgctaaggttggtcttcctacttactccacttcaagatcttttctcttttctattatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28998360 |
tttctggcaacatctacttttgagctctaggtctatgtcatgctaaggttgggcttcctacttactccacttcaagatcttttctcttttctattatgtt |
28998459 |
T |
|
| Q |
101 |
tccaaaaactctaataattaaggaatgttcttttttacttatcatacatatcatccatagatcttaactttc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28998460 |
tccaaaaactctaataattaaggaatgttcttttttacttatcatacatatcatccatagatcttaactttc |
28998531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University