View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10218_low_28 (Length: 221)

Name: NF10218_low_28
Description: NF10218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10218_low_28
NF10218_low_28
[»] chr4 (1 HSPs)
chr4 (14-205)||(32780932-32781123)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 32780932 - 32781123
Alignment:
14 cagagacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatggga 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32780932 cagagacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaagggaatggga 32781031  T
114 tggtccatctagatgggcagactaccttggaacagaaacgaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatgatg 205  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
32781032 tggtccatctagatgggcagactaccttggaacagaaacaaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatgatg 32781123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University