View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10218_low_5 (Length: 437)
Name: NF10218_low_5
Description: NF10218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10218_low_5 |
 |  |
|
| [»] scaffold0129 (1 HSPs) |
 |  |  |
|
| [»] scaffold0134 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 1e-57; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 231 - 424
Target Start/End: Complemental strand, 42637568 - 42637375
Alignment:
| Q |
231 |
atacaatgaaaaggatctcgtgtcatttaacttgaccactgagatgtttgttacaacatctacaccgacaaacaggaatgatattcgttatggatattta |
330 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||| ||||| |||||||| |||||||||| || |||||||| |||||||||| |||| |||| ||| |
|
|
| T |
42637568 |
atacaataaaaattatctcgtgtcatttaacttgactactgaaatgtttgtgacaacatctatactgacaaacacgaatgatattgattatagatactta |
42637469 |
T |
 |
| Q |
331 |
gcagtgttaaatgggtcaattgcgttggtttcaaattttgcaaacacaacaacttttcacatatcaattttgggtgaagttgggatgaaggaat |
424 |
Q |
| |
|
||| |||||||| |||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
42637468 |
gcaatgttaaatcggtcaattgcgttgatttcgaattttgcaaacacaactacttttcacatatcaattttgggtgaagtcggggtgaaggaat |
42637375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 69 - 202
Target Start/End: Complemental strand, 42637703 - 42637570
Alignment:
| Q |
69 |
ttattctttgtgggagatatattgtctaaaaagcaactcttggagaaagcttcatgtagatatgcctgcatgttctccatataatgcggatggtcgtgta |
168 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||| ||||| | |||| | || |||| ||| |
|
|
| T |
42637703 |
ttattctttgtgggagatatactgtctaaaaagcaactcttggagaaagcttgatgtagatatgccttcatcttctcgacataaagtgggcggtcatgtg |
42637604 |
T |
 |
| Q |
169 |
tacatggatggaatgtgtcattggttgagtaaaa |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
42637603 |
tacatggatggagtgtgtcattggttgagtaaaa |
42637570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 76 - 135
Target Start/End: Complemental strand, 42629991 - 42629932
Alignment:
| Q |
76 |
ttgtgggagatatattgtctaaaaagcaactcttggagaaagcttcatgtagatatgcct |
135 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||| || || |||||||| |
|
|
| T |
42629991 |
ttgtgggagatatattgtcttaaaagcaactcttggagaaaacttgatataaatatgcct |
42629932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 74 - 134
Target Start/End: Complemental strand, 9575808 - 9575748
Alignment:
| Q |
74 |
ctttgtgggagatatattgtctaaaaagcaactcttggagaaagcttcatgtagatatgcc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| || || |||||||||| |
|
|
| T |
9575808 |
ctttgtgggagatatattgtctaaaaagtaactattggagaaaactcgatatagatatgcc |
9575748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 424
Target Start/End: Original strand, 40545117 - 40545160
Alignment:
| Q |
381 |
aacttttcacatatcaattttgggtgaagttgggatgaaggaat |
424 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40545117 |
aacttttcacatatcaattttgggtgaagttggtgtgaaggaat |
40545160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 376 - 413
Target Start/End: Original strand, 37512892 - 37512929
Alignment:
| Q |
376 |
acaacaacttttcacatatcaattttgggtgaagttgg |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37512892 |
acaacaacttttcacatatcaattttgggtgaggttgg |
37512929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 79 - 133
Target Start/End: Complemental strand, 16487118 - 16487064
Alignment:
| Q |
79 |
tgggagatatattgtctaaaaagcaactcttggagaaagcttcatgtagatatgc |
133 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||| ||| |||| ||||||| |
|
|
| T |
16487118 |
tgggagatatatagtctaagaaacaactcttggagaaaacttgatgtcgatatgc |
16487064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 414
Target Start/End: Complemental strand, 15807783 - 15807754
Alignment:
| Q |
385 |
tttcacatatcaattttgggtgaagttggg |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15807783 |
tttcacatatcaattttgggtgaagttggg |
15807754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 410
Target Start/End: Complemental strand, 42629702 - 42629669
Alignment:
| Q |
377 |
caacaacttttcacatatcaattttgggtgaagt |
410 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
42629702 |
caacaacttttcatatatcaattttgggtgaagt |
42629669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 340 - 416
Target Start/End: Complemental strand, 41859772 - 41859696
Alignment:
| Q |
340 |
aatgggtcaattgcgttggtttcaaattttgcaaacacaacaacttttcacatatcaattttgggtgaagttgggat |
416 |
Q |
| |
|
||||| |||||||| | |||||||| || |||||| | || |||||||| |||||| |||| |||||||||||||| |
|
|
| T |
41859772 |
aatggatcaattgcatgggtttcaagttatgcaaagatgactacttttcatatatcagttttaggtgaagttgggat |
41859696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 422
Target Start/End: Original strand, 10484 - 10524
Alignment:
| Q |
382 |
acttttcacatatcaattttgggtgaagttgggatgaagga |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10484 |
acttttcacatatcaattttgggtgaagttggtgtgaagga |
10524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 424
Target Start/End: Original strand, 5162455 - 5162495
Alignment:
| Q |
384 |
ttttcacatatcaattttgggtgaagttgggatgaaggaat |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5162455 |
ttttcacatatcaattttgggtgaagttggtgtgaaggaat |
5162495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 76 - 135
Target Start/End: Complemental strand, 3368212 - 3368153
Alignment:
| Q |
76 |
ttgtgggagatatattgtctaaaaagcaactcttggagaaagcttcatgtagatatgcct |
135 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||||||| || || ||||||||||| |
|
|
| T |
3368212 |
ttgtgggagatatattctctaaaaaggaattcttggagaaaagttgatatagatatgcct |
3368153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0134 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0134
Description:
Target: scaffold0134; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 16294 - 16252
Alignment:
| Q |
382 |
acttttcacatatcaattttgggtgaagttgggatgaaggaat |
424 |
Q |
| |
|
||||||||||||||||||||||||||| |||| | |||||||| |
|
|
| T |
16294 |
acttttcacatatcaattttgggtgaaattggtaagaaggaat |
16252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 375 - 413
Target Start/End: Original strand, 29131310 - 29131348
Alignment:
| Q |
375 |
cacaacaacttttcacatatcaattttgggtgaagttgg |
413 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
29131310 |
cacaactacttttcacatatcaattttgggtgaatttgg |
29131348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 334 - 424
Target Start/End: Complemental strand, 32744977 - 32744887
Alignment:
| Q |
334 |
gtgttaaatgggtcaattgcgttggtttcaaattttgcaaacacaacaacttttcacatatcaattttgggtgaagttgggatgaaggaat |
424 |
Q |
| |
|
|||||||||||||| ||||| ||| | ||| ||| || ||| || || |||||||||||||||||| ||||||| |||| ||||| |||| |
|
|
| T |
32744977 |
gtgttaaatgggtccattgcattgatctcatattatgaaaagacgactacttttcacatatcaattatgggtgagattggtatgaaagaat |
32744887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 408
Target Start/End: Complemental strand, 44937870 - 44937838
Alignment:
| Q |
376 |
acaacaacttttcacatatcaattttgggtgaa |
408 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
44937870 |
acaactacttttcacatatcaattttgggtgaa |
44937838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University