View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_high_11 (Length: 314)
Name: NF10219_high_11
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 12 - 299
Target Start/End: Original strand, 3428438 - 3428725
Alignment:
| Q |
12 |
agagatgaatcgaaaggcaacagataaaaaatagttgcttt-ctgtgttatggagttgaagacttgaagaagtagcacataatattgcttgaggaggtgt |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428438 |
agagatgaatcgaaaggcaacatataaaaaatagttgcttttctgtgttatagagttgaagacttgaagaagtagcacataatattgcttgaggaggtgt |
3428537 |
T |
 |
| Q |
111 |
actttggttggctgtcatggggagcaaactagaatattccaaagcctatgggctcttctaacaatttggttaattttccgggcaacgaaagatgggagtc |
210 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428538 |
actt-ggttgactgtcatggggagcaaactagaatattccaaagcctatgggctcttctaacaatttggttaattttccgggcaacgaaagatgggagtc |
3428636 |
T |
 |
| Q |
211 |
cacgtttggctaaatcatgatcactttctgaagaattcaatgtagaagattcaccattactcttccgcagataaaaacttctactattt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428637 |
cacgtttggctaaatcatgatcactttctgaagaattcaatgtagaagattcaccattactcttccgcagataaaaacttctactattt |
3428725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University