View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_high_21 (Length: 233)
Name: NF10219_high_21
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 3162974 - 3163181
Alignment:
| Q |
17 |
acggacacgttgatattgataatatattgattagtgaaagtaattgaaaccagatgtatcgttgttgtgttggacagtggacacacatgcctctactcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3162974 |
acggacacgttgatattgataatatatttattagtgaaagtaattgaaaccagatgtatcgttgttgtgttggacagtggacacacatgcctctactcta |
3163073 |
T |
|
| Q |
117 |
aagtatcagtgaaatatacttgtttaacttatttaccatatattttgaagtgttaatagaatcctttgttaacagtgtaagttgatagaatcaaactgtg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3163074 |
aagtatcagtgaaatatacttgtttaacttatttaccatatattttgaagtgttaatagaatcctttgttaacagtgtaagttgatagaatcaaattgtg |
3163173 |
T |
|
| Q |
217 |
tgtctgtg |
224 |
Q |
| |
|
||| |||| |
|
|
| T |
3163174 |
tgtatgtg |
3163181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University