View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_high_22 (Length: 231)
Name: NF10219_high_22
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 4389700 - 4389876
Alignment:
| Q |
14 |
catagggatttacaaaacaaaatagatgcacatgaggacattggtaaaagctttggtgtgttttcgcttcatgatgatgaggatgtcttgcaaggcacgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389700 |
catagggatttacaaaacaaaatagatgcacatgaggacattggtaaaagctttggtgtgttttcgcttcatgatgatgaggatgtcttgcaaggcacgg |
4389799 |
T |
|
| Q |
114 |
tgaaattgcgcaggagcagtagaaagaagag---ggtgggagggtagcccaatgcggagtactgaaattccaccaag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389800 |
tgaaattgcgcaggagcagtagaaagaagagggtggtgggagggtagcccaatgcggagtactgaaattccaccaag |
4389876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 182 - 216
Target Start/End: Original strand, 4389897 - 4389931
Alignment:
| Q |
182 |
accaagaagaggtgagtggaatggtgtgttgtttc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389897 |
accaagaagaggtgagtggaatggtgtgttgtttc |
4389931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University