View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_high_26 (Length: 203)
Name: NF10219_high_26
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 30838923 - 30839094
Alignment:
| Q |
18 |
cttgggttttggtcccaacccacgannnnnnngaatgaaaaaagtactaaagagtgaagataaacttgtcacctaatcatgttcttatataatagtgtct |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30838923 |
cttgggttttggtcccaacccacgatttttttgaatgaaaaaagtactaaagagtgaagataaacttgtcacctaatcatgttcttatataatagtgtct |
30839022 |
T |
|
| Q |
118 |
gcaaaaagatgtagagagagaaagaggagggttccacgatcctacatggaatgtgaaaacagaatacctttg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30839023 |
gcaaaaagatgtagagagagaaagaggagggttccacgatcctacatggaatgtgaaaacagaatacctttg |
30839094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University