View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_high_9 (Length: 354)
Name: NF10219_high_9
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 34 - 341
Target Start/End: Original strand, 14762905 - 14763201
Alignment:
| Q |
34 |
tcaaggaatatagagacgtattgattggtatgcatcgtgaaacgttattatatatatcttgataggatattgcagcaagtggagtagtggtacttggtgt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14762905 |
tcaaggaatatagagacgtattgattggtatgcatcgtgaaacgttattatatatatcttgataggatattgcagcaagtggagtagtggtacttggtgt |
14763004 |
T |
 |
| Q |
134 |
gctaatttaattgacacattgttataatatctagataggatatgtactctgcactgcagtttacggttgtgcagagggtggttaggagggtggcaataat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14763005 |
gctaatttaattgacacattgttataatatctagataggatatgtactctgcactgcagtttgcggttgtgcagagggtggttaggagg----------- |
14763093 |
T |
 |
| Q |
234 |
gtggcaataatgtggcgggtattggctgggaaactctttgtaaccctgtcctaattttgtgatgttaatttgctggtaggttatttaaaaggactaggtt |
333 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14763094 |
gtggcaataatgtggcggttattggctgggaaactctttggaacactgtcctaattttgtgatgttaatttgctggtaggttatttaaaaggactgggtt |
14763193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University