View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_low_18 (Length: 273)
Name: NF10219_low_18
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 40970121 - 40969870
Alignment:
| Q |
6 |
agaagcagagatgttgtttgttcagttcatgagaagttgtaatgataaaccaaaagaatacattttagctagtatcgttaaagcttgcacgcaatttgtt |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||||| |||||| ||||||||| ||||||| | |
|
|
| T |
40970121 |
agaagcattgatgttgtttgttcagttcatgagaagttgtaacgagaaaccaaatgaatacattttagctagtgtcgttagagcttgcactcaatttggt |
40970022 |
T |
|
| Q |
106 |
ggtctcgaccaagctctacagatacatggtttggttgttaagggtggatatgttcaagatgttgtcgtgtgtaactctttgattgatttttataccaaac |
205 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||| |
|
|
| T |
40970021 |
ggtctcaacccagctctacagatacatggtttggttgttaagggtggatatgttcaagatgtttatgtgtgtacctctttgattgatttttacaccaaac |
40969922 |
T |
|
| Q |
206 |
atggttgtattgatgatgcaaggttgctttttgatggtttacaagttaaaac |
257 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40969921 |
atgcttgtattgatgatgcaaggttgctttttgatggcctacaagttaaaac |
40969870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University