View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_low_23 (Length: 254)
Name: NF10219_low_23
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_low_23 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 37045184 - 37045422
Alignment:
| Q |
16 |
atgaatactcaaacattttagaatgcaacaactagaaatacttgccagaatttaggatgtgtggaaatattaaattaaattttctacaggctaaaatttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37045184 |
atgaatactcaaacattttagaatgcaacaaccagaaatacttgccagaatttaggatgtgtggaaatattaaattaaattttctacaggctaaaatttg |
37045283 |
T |
|
| Q |
116 |
tttaattgtaaagcaaggaaaacatgtactctatagaaacatttaatttactgcaatatttattaccttaattatacttggatggtttcttttttctgta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37045284 |
tttaattgtaaagcaaggaaaacatgtactctatagaaacatttaatttactgcaatatttattaccttaattatacttggatggtttcttttttctgta |
37045383 |
T |
|
| Q |
216 |
tttgagaatactgcaaattctccctcaaattggaatgaa |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37045384 |
tttgagaatactgcaaattctccctcaaattggaatgaa |
37045422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 172 - 254
Target Start/End: Original strand, 37036001 - 37036083
Alignment:
| Q |
172 |
tatttattaccttaattatacttggatggtttcttttttctgtatttgagaatactgcaaattctccctcaaattggaatgaa |
254 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||||||||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
37036001 |
tatttgttaccttaactatacttggatgatttcttttttctgtattcaggaacactgcatattctccctcaaattggaatgaa |
37036083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University