View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_low_29 (Length: 237)
Name: NF10219_low_29
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39970726 - 39970947
Alignment:
| Q |
1 |
tgcttcagacagcagtaatgtgaaaattaaaggtgaagttgaggattccgttcaatcagctacaaaggttcgatgtctctgtggaagttcattggaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39970726 |
tgcttcagacagcagtaatgtgaaaattaaaggtgaagttgaggattccgttcaatcagctacaaaggttcgatgtctctgtggaagttcattggaaaca |
39970825 |
T |
|
| Q |
101 |
gatctattgatcaaggtataatattcactatatttcttctatcctcacgattcataaaattatatgcttctttacattctcgtaggatttcattgatcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39970826 |
gatctattgatcaaggtataatattcactatatttcttctatcctcacgattcataaaattatatgcttctttacattctcgtaggatttcattgatcat |
39970925 |
T |
|
| Q |
201 |
ttccattattttccttgatgtc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39970926 |
ttccattattttccttgatgtc |
39970947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 60 - 140
Target Start/End: Complemental strand, 22264787 - 22264707
Alignment:
| Q |
60 |
ctacaaaggttcgatgtctctgtggaagttcattggaaacagatctattgatcaaggtataatattcactatatttcttct |
140 |
Q |
| |
|
|||||||| |||| ||||||||||||||| |||||||||||| ||||||||||| || ||||| |||||||||||| |
|
|
| T |
22264787 |
ctacaaagattcgctgtctctgtggaagtacattggaaacaggggatttgatcaaggtgaaacattcaatatatttcttct |
22264707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University