View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_low_30 (Length: 237)
Name: NF10219_low_30
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 230
Target Start/End: Original strand, 37480943 - 37481143
Alignment:
| Q |
30 |
acaaaatagcaaaaagcaagatggaaaagcctcctacggtcctaccaggtactacaaggaaaattgcgactcaaacgtagctaaagaaagcaattggagg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37480943 |
acaaaatagcaaaaagcaagatggaaaagcctcctacggtcctaccaggtactacaaggaaaattgcgactcaaacgtagctaaagaaagcaattggagg |
37481042 |
T |
 |
| Q |
130 |
tttagggccaaaattattagagacaatgaggaaagagtttggtgggtacttgggttgtgtaggacttcaatgacactgctacgatcgaatccaggcctat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
37481043 |
tttagggccaaaattattagagacaatgaggaaagagtttggtgggtacttgggttgtgtaggacttcaatgacactactacgatcgaatccaggcttat |
37481142 |
T |
 |
| Q |
230 |
g |
230 |
Q |
| |
|
| |
|
|
| T |
37481143 |
g |
37481143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University