View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_low_34 (Length: 226)
Name: NF10219_low_34
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 38791978 - 38791860
Alignment:
| Q |
19 |
agttttcaaccgaaggaacagcataccacgcaacagtcaacaataaccaacttattattagatgtgaccgaaatgaaaatgaaagggttactttcgtgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38791978 |
agttttcaaccgaaggaacagcataccacgcaacagtcaacaataaccaacttattattagatgtga-cgaaatgaaaatgaaagggttactttcgtgga |
38791880 |
T |
 |
| Q |
119 |
cctagagaaaataatgttca |
138 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38791879 |
cctagagaaaataatgttca |
38791860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University