View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10219_low_36 (Length: 205)
Name: NF10219_low_36
Description: NF10219
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10219_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 2 - 138
Target Start/End: Complemental strand, 3616745 - 3616608
Alignment:
| Q |
2 |
tttttaatacctctttaaatcgtattgtgaaaacaatttaggttacatcagccgtattcgattgtgattctcaagaagttagagatcgtgatgcaaccac |
101 |
Q |
| |
|
|||| |||| || |||||||||| ||||||| ||||||||||||||| || ||||||| |||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
3616745 |
ttttaaatatctttttaaatcgtgttgtgaacgcaatttaggttacataagtcgtattcaattgtgattctcgagaagttagagattgtgatgcaaccac |
3616646 |
T |
|
| Q |
102 |
atttatgagagtaatttaaaaa-ttttgtatattattc |
138 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3616645 |
atttatgagagtaatttaaaaacttttgtatattattc |
3616608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University