View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1021_high_2 (Length: 460)
Name: NF1021_high_2
Description: NF1021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1021_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 24 - 174
Target Start/End: Complemental strand, 39540358 - 39540208
Alignment:
| Q |
24 |
agtagtttttccttgttgtttctgcttcacccatctcaaggagaatttatcatcattaggatatattttggaaaatgcttaatgtcacaaaacattattt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39540358 |
agtagtttttccttgttgtttctgcttcacccatctcaaggagaatttatcatcattaggatatattttggaaaatgcttaatgtcgcaaaacattattt |
39540259 |
T |
|
| Q |
124 |
cttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39540258 |
cttgaaaaaacacgaataggctgacaaagggtaaaacgttgaaaacaagta |
39540208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 295 - 381
Target Start/End: Original strand, 437632 - 437718
Alignment:
| Q |
295 |
gtttgtgccgagtcggagcgcgccgagtctctgagtttgattcggtttaaggatgatatgtattttccttcctactaaattgcattg |
381 |
Q |
| |
|
||||||| ||||||||| || || ||||||| |||||| | |||||| |||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
437632 |
gtttgtgtcgagtcggaacgtgctgagtctccgagtttcactcggttcaaggatgagatctattttccttcctcctaaattgcattg |
437718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University