View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1021_low_10 (Length: 209)

Name: NF1021_low_10
Description: NF1021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1021_low_10
NF1021_low_10
[»] chr2 (1 HSPs)
chr2 (1-111)||(37138310-37138420)


Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 37138420 - 37138310
Alignment:
1 cacacttgtatccaaaaatccaaactttcacaccaatctctaacatattctaaataacataaattgactacggataaaaatttaatgtcattatattatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37138420 cacacttgtatccaaaaatccaaactttcacaccaatctctaacatattctaaataacataaattgactacggataaaaatttaatgtcattatattatc 37138321  T
101 caacccatatg 111  Q
    |||||||||||    
37138320 caacccatatg 37138310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University