View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1021_low_5 (Length: 339)
Name: NF1021_low_5
Description: NF1021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1021_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 95 - 327
Target Start/End: Original strand, 33384887 - 33385119
Alignment:
| Q |
95 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384887 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
33384986 |
T |
|
| Q |
195 |
atggcggtttggtactggatggctttcttgtgccacaagtaattctaaacttgttttcaaatatgaatgagaatgttctttcatgttcattttactttgg |
294 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384987 |
atggcggtttggtattggatggctttcttgtgccacaagtaattctaaacttgttttcaaatatgaatgagaatgttctttcatgttcattttactttgg |
33385086 |
T |
|
| Q |
295 |
aactacttttgtgagactcttgccgcatgccta |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33385087 |
aactacttttgtgagactcttgccgcatgccta |
33385119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 161 - 324
Target Start/End: Original strand, 33378845 - 33379008
Alignment:
| Q |
161 |
caacatgattcatcttgggagaacatgaaatcttatggcggtttggtactggatggctttcttgtgccacaagtaattctaaacttgttttcaaatatga |
260 |
Q |
| |
|
||||||||| | |||||||||| ||| ||||||||||| ||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33378845 |
caacatgatccgtcttgggagagcataaaatcttatggtggtttggtattggattgctttcttgtgccacaagtcattctaaacttgttttcaaatatga |
33378944 |
T |
|
| Q |
261 |
atgagaatgttctttcatgttcattttactttggaactacttttgtgagactcttgccgcatgc |
324 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33378945 |
atgagaatgttctttcatgctcattttactttggaactacttttgtgagactcttgccacatgc |
33379008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University