View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1021_low_7 (Length: 280)
Name: NF1021_low_7
Description: NF1021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1021_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 35 - 246
Target Start/End: Complemental strand, 5032895 - 5032685
Alignment:
| Q |
35 |
gaaataaacgcaaatacttttatacataaaattgaaggtctttcatgtcttaagctgtgatactattctcttaccttaacttctaaatttttgtaacnnn |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5032895 |
gaaataaacgcaaatacttttatacataaaattgaaggtctttcatgccttaagctgtcatactattctcttaccttaacttctaaatttttgtaacaaa |
5032796 |
T |
 |
| Q |
135 |
nnnnnnttaacaatactcatagctttatatgcacctttaccctaattcaaacacaaaagcctagattttatagttgtgtgtgcaaatttaaatgatatac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5032795 |
aaaaa-ttaacaatactcatagctttatatgcacctttaccctaattcaaacacaaaagcctagattttatagttgtgtgtgcaaatttaaatgatatac |
5032697 |
T |
 |
| Q |
235 |
cttcttttctgt |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
5032696 |
gttcttttctgt |
5032685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University