View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10220_low_5 (Length: 247)
Name: NF10220_low_5
Description: NF10220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10220_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 25 - 240
Target Start/End: Complemental strand, 11048244 - 11048013
Alignment:
| Q |
25 |
gatacttgacactttttctcctcattaattgattgcatatcaaaattcctaacctacaaaatacaaaggcaataacgagcttcctcttgatttgaatttc |
124 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11048244 |
gatacttaacactttttctcctcattaattgattgcatatcaaaatttctaacctacaaaatacaaaggcaataacaagcttcctcttgatttgaatttc |
11048145 |
T |
|
| Q |
125 |
aggtgttcac----------------actaaatttataaggtcatttgtgggagaagaagtgtctagctggaagcgtgtatgagtgtgttcaatgaattt |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11048144 |
aggtgttcacactcataagtaattgaactaaatttataaggtcatttgtgggagaagaagtgtctagctggaagcgtgtatgagtgtgttcaatgaattt |
11048045 |
T |
|
| Q |
209 |
ggtttgcaacattaaattatgtgtgatgatgt |
240 |
Q |
| |
|
||||||||| ||||||||||||||||| |||| |
|
|
| T |
11048044 |
ggtttgcaagattaaattatgtgtgattatgt |
11048013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 129
Target Start/End: Original strand, 10565949 - 10566012
Alignment:
| Q |
66 |
aaaattcctaacctacaaaatacaaaggcaataacgagcttcctcttgatttgaatttcaggtg |
129 |
Q |
| |
|
||||||||||| ||||||||||||| || ||||| | ||| ||||||||||||||||||||| |
|
|
| T |
10565949 |
aaaattcctaaactacaaaatacaatggtaataatggatttcttcttgatttgaatttcaggtg |
10566012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University