View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10221_high_6 (Length: 240)
Name: NF10221_high_6
Description: NF10221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10221_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 20090083 - 20090154
Alignment:
| Q |
1 |
aaacctaattcctttatataaagaatgagaagctatgaatccgatacttcccgtaaagaaaattgataccct |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
20090083 |
aaacctaattcctttatataaagaatgagaagctatgaatccgatacttcctgtaaagaaaatggataccct |
20090154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 240
Target Start/End: Original strand, 20124891 - 20124920
Alignment:
| Q |
211 |
tgtgtattgctttatttttattcctttctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20124891 |
tgtgtattgctttatttttattcctttctt |
20124920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University