View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10221_low_10 (Length: 242)
Name: NF10221_low_10
Description: NF10221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10221_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 46574573 - 46574730
Alignment:
| Q |
1 |
ttgacagtatagtatttagactgtagcccgtcaacatattttacaataaataaattgcttcggactaagatacatac-atatctagtcatctagagaaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
46574573 |
ttgacagtatagtatttagactgtagcccgtcaacatattttacaataaataaattgcttcggactaagatacatactatatctagtcatctagaggaat |
46574672 |
T |
|
| Q |
100 |
aatatgtttgttaaagtctgctgcgaaacgttgtttccgatttcaattcgtaaacttg |
157 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46574673 |
aatatgtttgttgaagtctgctgcgaaacgttgtttccgatttcaattcgtaaacttg |
46574730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University