View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10221_low_12 (Length: 240)

Name: NF10221_low_12
Description: NF10221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10221_low_12
NF10221_low_12
[»] chr3 (2 HSPs)
chr3 (1-72)||(20090083-20090154)
chr3 (211-240)||(20124891-20124920)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 20090083 - 20090154
Alignment:
1 aaacctaattcctttatataaagaatgagaagctatgaatccgatacttcccgtaaagaaaattgataccct 72  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||    
20090083 aaacctaattcctttatataaagaatgagaagctatgaatccgatacttcctgtaaagaaaatggataccct 20090154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 240
Target Start/End: Original strand, 20124891 - 20124920
Alignment:
211 tgtgtattgctttatttttattcctttctt 240  Q
    ||||||||||||||||||||||||||||||    
20124891 tgtgtattgctttatttttattcctttctt 20124920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University