View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10221_low_6 (Length: 267)
Name: NF10221_low_6
Description: NF10221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10221_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 46905168 - 46904931
Alignment:
| Q |
18 |
gagggattggagagctgctgcggagggtagaattgagcgtagagggttgccggcaaaggcattaaagttaaagtttatggacatggtggttactggttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46905168 |
gagggattggagagctgctgcggagggtagaattgagcgtagagggttgccggcaaaggcattaaagttaaagtttatggacatggtggttactggttga |
46905069 |
T |
|
| Q |
118 |
ggaagcttgcagaagaagaaaggtttttggaaaacggattgtaaagg-agaaaggtgcagatgagctgctttgttttgatttttcagcaaggtgggaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46905068 |
ggaagcttgcagaagaagaaaggtttttggaaaacggattgtaaaggaagaaaggtgcagatgagctgctttgttttgatttttcagcaaggtgggaagg |
46904969 |
T |
|
| Q |
217 |
aaggaaaaagagaccaaaaagttggttggtcactgcct |
254 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
46904968 |
aaggatgaagagaccaaaaagtttgttggtcactgcct |
46904931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University