View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10221_low_8 (Length: 250)
Name: NF10221_low_8
Description: NF10221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10221_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 36084113 - 36083898
Alignment:
| Q |
1 |
tatgcatttataaatctttgtgcaaagtttcaaaatcatggtcgcggccacgcagtaatctttgatattgtagaaaatcacggataaatacaacttgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36084113 |
tatgcatttataaatctttgtgcaaagtttcaaaatcatggtcgcggccacgcattaatatttgatattgtagaaaattgcggataaatacaacttgtgt |
36084014 |
T |
 |
| Q |
101 |
ttccgcaatagcgatcacaatttgatgtccgtgacaatataacgttgaaaacgctgctatattttccgttgcagaccgttttttaaaaccttgaccaaga |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||| | | ||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
36084013 |
ttccgcgatagcgatcacaatttgatgttggtgacaatataacgttgaaatcacggctatatttgccgttgcagaccattttttaaaaccttgaccaaga |
36083914 |
T |
 |
| Q |
201 |
tttaaggattagcttt |
216 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
36083913 |
tttaaggactagcttt |
36083898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University