View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10221_low_9 (Length: 245)
Name: NF10221_low_9
Description: NF10221
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10221_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 233
Target Start/End: Original strand, 34674801 - 34675026
Alignment:
| Q |
8 |
gagaagcaaaggcagtgcaagtaagtgtgtgtggatgaaaaagcttacacttgaaggggagtatagtgaatggaaatcactcgtacttgagagcatagat |
107 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34674801 |
gagaaccaatggcagtgcaagtaagtgtgtgtggatgaaaaagcttacacttgaaggggagtatagtgaatggaaatcactcgtacttgagagtggagat |
34674900 |
T |
|
| Q |
108 |
tgttgtggcaagtgtgaggtgagtaagaattcacatatttcttaaaaaagtagaggttgaacaatttacaagtgaaatgtccataaatctattatcttaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34674901 |
tgttgtggcaagtgtgaggtgagtaagaattcacatatttcttaaaaaagtagaggttgaacaatttacaagtgaaatgtccataaatctattatcttaa |
34675000 |
T |
|
| Q |
208 |
aatttcggatcaagatgtgatgtcca |
233 |
Q |
| |
|
||||| |||||||||||||||||||| |
|
|
| T |
34675001 |
aattttggatcaagatgtgatgtcca |
34675026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University