View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10222_high_13 (Length: 243)
Name: NF10222_high_13
Description: NF10222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10222_high_13 |
 |  |
|
| [»] scaffold0133 (2 HSPs) |
 |  |  |
|
| [»] scaffold0256 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0133 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: scaffold0133
Description:
Target: scaffold0133; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 3 - 136
Target Start/End: Original strand, 14129 - 14261
Alignment:
| Q |
3 |
tcaaagagaatccaataccaaataattgtaatactaattattatttaatatttcaagtttggcagtgtacctgaagttcaagtggatcaagtatggtggg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14129 |
tcaaagagaatccaataccaaataattgtaatactaattattatttaatatttcaagtt-ggcagtgtacctgaagtgcaagtggatcaagtatggtggg |
14227 |
T |
 |
| Q |
103 |
atggcatcaagttggcaagtgtataatttagctg |
136 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
14228 |
atggtatcaagttggcaagtgtataatttagctg |
14261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0133; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 9788 - 9909
Alignment:
| Q |
1 |
catcaaagagaatccaataccaaataattgtaatactaattattatttaatatttcaagtttggcagtgtacctgaagttcaagtggatcaagtatggtg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9788 |
catcaaagaaaatccaataccaaataattgtaatactaattattatttaatatttcaagtt-ggcagtgtacctgaagtgcaagtggatcaagtatggtg |
9886 |
T |
 |
| Q |
101 |
ggatggcatcaagttggcaagtg |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9887 |
ggatggcatcaagttggcaagtg |
9909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 10408 - 10497
Alignment:
| Q |
1 |
catcaaagagaatccaataccaaataattgtaatactaattattatttaatatttcaagtttggcagtgtacctgaagttcaagtggatcaagt |
94 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| |||| |||||||| ||||| |
|
|
| T |
10408 |
catcaaagagaatccaataccatataattgtaatacta---attatttaatatttcaag-ttggcagtgtacctcaagtgcaagtggagcaagt |
10497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 117 - 175
Target Start/End: Original strand, 10492 - 10547
Alignment:
| Q |
117 |
gcaagtgtataatttagctgctgtttggtctggaatatgaaatttcatctatatctatt |
175 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
10492 |
gcaagtgtataatttagctg---tttggtcaggaatatgaaatttcaactatatctatt |
10547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 226
Target Start/End: Original strand, 10564 - 10615
Alignment:
| Q |
171 |
ctattgtttatctcaaaataataggtatatatccttgcttggcgtctttctttaat |
226 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
10564 |
ctattgtttatctcaaaataatagg----tatcctttcttggcgtctttctttaat |
10615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University