View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10222_high_5 (Length: 318)
Name: NF10222_high_5
Description: NF10222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10222_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 19 - 307
Target Start/End: Complemental strand, 42246734 - 42246446
Alignment:
| Q |
19 |
gtggtatcgtggcgttgggcaatgcatagggtgcatatgtatccttgttttttctacgaatggttgtggcgcccgagagactgcagccttcgctaacttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246734 |
gtggtatcgtggcgttgggcaatgcatagggtgcatatgtatccttgttttttctacgaatggttgtggcgcccgagagactgcagccttcgctaacttc |
42246635 |
T |
 |
| Q |
119 |
cttcagtgatgggttcctggtgttttttcctttgctgttttgtcgtgttggttcagatctggtgtggttcagttgctgcagtgtgctttaccctcaaggg |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246634 |
cttcagtggtgggttcctggtgttttttcctttgctgttttgtcgtgctggttcaaatctggtgtggttcagttgctgcagtgtgctttaccctcaaggg |
42246535 |
T |
 |
| Q |
219 |
ggagatgttgcagggagtggttgctgcagttttgaggtgtttgctgctgctatcagcgttttctcctgacctgccgtgtccggtttcat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246534 |
ggagatgttgcagggagtggttgctgcagttttgaggtgtttgctgctgctatcagcgttttctcctgacctgccgtgtccggtttcat |
42246446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University