View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10222_low_11 (Length: 278)
Name: NF10222_low_11
Description: NF10222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10222_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 268
Target Start/End: Original strand, 7382884 - 7383127
Alignment:
| Q |
24 |
atctccggagtggggaaatgttgaggcaaa-tctaacaaagctaacaaagaagattctatgttgtggattattttggatcatcaattacatattagaaga |
122 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7382884 |
atctccggtgtggggaaaagttgaggcaaaatctaacaaagctaacaaagaagattctat--tgtggattattttggatcatcaattacatattagaaga |
7382981 |
T |
|
| Q |
123 |
cccatgatggtgtaagcatttgtgcttcacaagagctatcgctatcttttgactccnnnnnnntactaagagctattatcactatctcatttgcattcaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7382982 |
cccatgatggtgtaagcatttgtgcttcacaagagctatcgctatcttttgactccaaaaaaatactaagagctattatcactatctcatttgcattcaa |
7383081 |
T |
|
| Q |
223 |
aaattcaattcacatgtcatgaaaaacttacaaaactaatcctatg |
268 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7383082 |
aaattcaattcacgtgtcatgaaaaacttacaaaactaatcctatg |
7383127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University