View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10222_low_12 (Length: 268)
Name: NF10222_low_12
Description: NF10222
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10222_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 34149682 - 34149932
Alignment:
| Q |
1 |
aactggcttgagtggtcgaagcagtggcaaggtctccactgcacctactgcacctccaactcctcgaactgagggcgagatcttgaagtcttccaatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149682 |
aactggcttgagtggtcgaagcagtggcaaggtctccactgcacctactgcacctccaactcctcgaactgagggcgagatcttgaagtcttccaatatg |
34149781 |
T |
 |
| Q |
101 |
aagagcttcacttttagtgagctaaaaactgctacaagaaactttcgtcccgatagtgtggttggcgaaggtggattcggagctgtatttaaggggtgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149782 |
aagagcttcacttttagtgagctaaaaactgctacaagaaactttcgtcccgacagtgtggttggcgaaggtggattcggagctgtatttaaggggtgga |
34149881 |
T |
 |
| Q |
201 |
tcgatgagaacacactagtaccggttagaccagggactggagttgtcattg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149882 |
tcgatgagaacacactagtaccggttagaccagggactggagttgtcattg |
34149932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 218
Target Start/End: Original strand, 30421305 - 30421389
Alignment:
| Q |
134 |
acaagaaactttcgtcccgatagtgtggttggcgaaggtggattcggagctgtatttaaggggtggatcgatgagaacacactag |
218 |
Q |
| |
|
||||| ||||||||||| |||||| || |||||||||||||||| || |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30421305 |
acaaggaactttcgtccagatagtatgattggcgaaggtggatttggttgtgtatttaagggttggatcgatgagcacacactag |
30421389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 134 - 218
Target Start/End: Original strand, 30404447 - 30404531
Alignment:
| Q |
134 |
acaagaaactttcgtcccgatagtgtggttggcgaaggtggattcggagctgtatttaaggggtggatcgatgagaacacactag |
218 |
Q |
| |
|
||||| ||||||| ||| |||||| || ||||| |||||||||| || |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
30404447 |
acaaggaactttcatccagatagtatgattggcaaaggtggatttggttgtgtatttaagggttggatcgatgagcacacactag |
30404531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University